-
PurposeExpresses human interleukin-6 (IL6) fused to GFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInterleukin 6
-
Alt nameIL-6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)647
-
MutationCodon optimized for expression in human cells
-
GenBank IDNM_000600.4
-
Entrez GeneIL6 (a.k.a. BSF-2, BSF2, CDF, HGF, HSF, IFN-beta-2, IFNB2, IL-6)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATT
- 3′ sequencing primer GTCCAGCTCGACCAGGATGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic gene from Genscript
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N1-IL6 was a gift from Geert van den Bogaart (Addgene plasmid # 111933 ; http://n2t.net/addgene:111933 ; RRID:Addgene_111933) -
For your References section:
Interleukin-6 secretion is limited by self-signaling in endosomes. Verboogen DRJ, Revelo NH, Ter Beest M, van den Bogaart G. J Mol Cell Biol. 2018 Jul 16. pii: 5054600. doi: 10.1093/jmcb/mjy038. 10.1093/jmcb/mjy038 PubMed 30016456