Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCB30
(Plasmid #111910)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111910 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pRS424Multi_KanM-Trp
  • Backbone manufacturer
    Stanford Genome Technology Center
  • Modifications to backbone
    Removed Leu marker and replaced with gRNA cassette
  • Vector type
    Bacterial Expression, Yeast Expression, CRISPR
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA cassette targeting URA3 knockout locus
  • gRNA/shRNA sequence
    ACCATCAAAGAAGGTTAATG
  • Species
    S. cerevisiae (budding yeast)
  • Promoter SNR52p

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer agcttgtctgtaagcgga
  • 3′ sequencing primer cctatggaaaaacgccagAAT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCB30 was a gift from Yi Tang (Addgene plasmid # 111910 ; http://n2t.net/addgene:111910 ; RRID:Addgene_111910)