pONSY-CoH2B:Venus
(Plasmid
#111877)
-
PurposeThis plasmid expresses Venus fluorescent protein fused to endogenous Histone H2B (H2B) gene of Capsaspora (CAOG_01818). It can be used to transfect Capsaspora cells and visualize nucleus in vivo.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111877 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepONSY
- Backbone size w/o insert (bp) 5127
-
Modifications to backboneCapsaspora expression vector (backbone) modified from the pCR2.1 vector. It bears the promoter and terminator regions from the endogenous Elongation Factor 1 alpha (EF1a) gene (CAOG_07807) cloned using Restriction Enzymes and Gibson Assembly strategies.
-
Vector typeCapsaspora owczarzaki
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCapsaspora Histone H2B (CoH2B) fused to Venus
-
SpeciesCapsaspora owczarzaki
-
Insert Size (bp)1113
-
GenBank IDCAOG_01818
- Promoter Elongation Factor 1 alpha (EF1a) from Capsaspora
-
Tag
/ Fusion Protein
- Venus (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (not destroyed)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer TACCCGGGATGCCGCCGAAGGTC
- 3′ sequencing primer TAACTAGTCTTGGCGCCGGAGGT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pONSY-CoH2B:Venus was a gift from Inaki Ruiz-Trillo (Addgene plasmid # 111877 ; http://n2t.net/addgene:111877 ; RRID:Addgene_111877) -
For your References section:
Transfection of Capsaspora owczarzaki, a close unicellular relative of animals. Parra-Acero H, Ros-Rocher N, Perez-Posada A, Kozyczkowska A, Sanchez-Pons N, Nakata A, Suga H, Najle SR, Ruiz-Trillo I. Development. 2018 May 11. pii: dev.162107. doi: 10.1242/dev.162107. 10.1242/dev.162107 PubMed 29752387