pONSY-CoH2B:Venus
(Plasmid #111877)

• Purpose: This plasmid expresses Venus fluorescent protein fused to endogenous Histone H2B (H2B) gene of Capsaspora (CAOG_01818). It can be used to transfect Capsaspora cells and visualize nucleus in vivo.
• Depositing Lab: Inaki Ruiz-Trillo
• Publication: Parra-Acero et al Development. 2018 May 11. pii: dev.162107. doi: 10.1242/dev.162107.

Backbone

• Vector backbone: pONSY
• Backbone size w/o insert (bp): 5127
• Modifications to backbone: Capsaspora expression vector (backbone) modified from the pCR2.1 vector. It bears the promoter and terminator regions from the endogenous Elongation Factor 1 alpha (EF1a) gene (CAOG_07807) cloned using Restriction Enzymes and Gibson Assembly strategies.
• Vector type: Capsaspora owczarzaki

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Kanamycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Capsaspora Histone H2B (CoH2B) fused to Venus
• Species: Capsaspora owczarzaki
• Insert Size (bp): 1113
• GenBank ID: CAOG_01818
• Promoter: Elongation Factor 1 alpha (EF1a) from Capsaspora
• Tag / Fusion Protein:
  • Venus (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (not destroyed)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: TACCCGGGATGCCGCCGAAGGTC
• 3′ sequencing primer: TAACTAGTCTTGGCGCCGGAGGT

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry