pDNA2.0 6H-TEV-KRAS G12V
(Plasmid #111850)

• Purpose: Expresses activated human KRAS G12V (amino acids 1 - 169) in E. coli with amino terminal 6xHIS tag that can be removed with TEV protease.
• Depositing Lab: Kenneth Westover
• Publication: Hunter et al Mol Cancer Res. 2015 Sep;13(9):1325-35. doi: 10.1158/1541-7786.MCR-15-0203. Epub 2015 Jun 2.

Backbone

• Vector backbone: pDNA2.0
• Backbone manufacturer: ATUM
• Backbone size w/o insert (bp): 3939
• Total vector size (bp): 4500
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: KRAS G12V
• Alt name: Kirsten ras oncogene G12V
• Species: H. sapiens (human)
• Insert Size (bp): 507
• Mutation: Changed Glycine 12 to Valine
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Promoter: T5
• Tags / Fusion Proteins:
  • 6xHis-tag (N terminal on backbone)
  • TEV protease cleavage sequence (N terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGAATTGTGAGCGCTCACAA
• 3′ sequencing primer: GAACTGCCAGGCATCAAATAAAA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry