pRRL-VinculinTS-I997A
(Plasmid
#111832)
-
PurposeVinculin tension sensor with point mutation affecting ability to bind actin in lentiviral expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 6235
- Total vector size (bp) 11602
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVinculinTS (I997A)
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)5367
-
Mutationchanged vinculin isoleucine 997 to alanine
-
Entrez GeneVCL (a.k.a. VINC1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGTACAGTGCAGGGGAAAG
- 3′ sequencing primer GTTAAGAATACCAGTCAATCTTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-VinculinTS-I997A was a gift from Brenton Hoffman (Addgene plasmid # 111832 ; http://n2t.net/addgene:111832 ; RRID:Addgene_111832) -
For your References section:
Vinculin Force-Sensitive Dynamics at Focal Adhesions Enable Effective Directed Cell Migration. Rothenberg KE, Scott DW, Christoforou N, Hoffman BD. Biophys J. 2018 Apr 10;114(7):1680-1694. doi: 10.1016/j.bpj.2018.02.019. 10.1016/j.bpj.2018.02.019 PubMed 29642037