Skip to main content
Addgene

pCRISPR_RAF1_94
(Plasmid #111826)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111826 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    All_in_one_CRISPR/Cas9_LacZ
  • Backbone manufacturer
    Lynne Postovit (Addgene plasmid # 74293)
  • Backbone size w/o insert (bp) 10694
  • Total vector size (bp) 10394
  • Modifications to backbone
    Removal of LacZ-alpha in the cloning process
  • Vector type
    Mammalian Expression, Bacterial Expression, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting RAF1 94-114
  • gRNA/shRNA sequence
    GCCGCCCGAGAGTCTTAATCG
  • Species
    H. sapiens (human)
  • Entrez Gene
    RAF1 (a.k.a. CMD1NN, CRAF, NS5, Raf-1, c-Raf)
  • Promoter U6
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer SP6 Forward: ATTTAGGTGACACTATAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR_RAF1_94 was a gift from Steve Shih (Addgene plasmid # 111826 ; http://n2t.net/addgene:111826 ; RRID:Addgene_111826)
  • For your References section:

    An automated microfluidic gene-editing platform for deciphering cancer genes. Sinha H, Quach ABV, Vo PQN, Shih SCC. Lab Chip. 2018 Jul 24;18(15):2300-2312. doi: 10.1039/c8lc00470f. 10.1039/c8lc00470f PubMed 29989627