pCRISPR_eGFP_369
(Plasmid #111823)

• Purpose: Knockout eGFP
• Depositing Lab: Steve Shih
• Publication: Sinha et al Lab Chip. 2018 Jul 24;18(15):2300-2312. doi: 10.1039/c8lc00470f.

Backbone

• Vector backbone: All_in_one_CRISPR/Cas9_LacZ
• Backbone manufacturer: Lynne Postovit (Addgene plasmid # 74293)
• Backbone size w/o insert (bp): 10694
• Total vector size (bp): 10394
• Modifications to backbone: Removal of LacZ-alpha in the cloning process
• Vector type: Mammalian Expression, Bacterial Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gRNA targeting eGFP 349-369
• gRNA/shRNA sequence: TCGATGCCCTTCAGCTCGATG
• Species: H. sapiens (human), Synthetic
• Promoter: U6
• Tag / Fusion Protein:
  • mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: SP6 Forward: ATTTAGGTGACACTATAGA

Resource Information

• Supplemental Documents:
  • sgrna_egfp_369.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry