-
PurposeRetroviral expression vector for direct cardiac reprogramming
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111810 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepMx
- Backbone size w/o insert (bp) 5871
- Total vector size (bp) 8929
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC
- 3′ sequencing primer ATAAAATCTTTTATTTTATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMx-MGT was a gift from Li Qian (Addgene plasmid # 111810 ; http://n2t.net/addgene:111810 ; RRID:Addgene_111810) -
For your References section:
Stoichiometry of Gata4, Mef2c, and Tbx5 influences the efficiency and quality of induced cardiac myocyte reprogramming. Wang L, Liu Z, Yin C, Asfour H, Chen O, Li Y, Bursac N, Liu J, Qian L. Circ Res. 2015 Jan 16;116(2):237-44. doi: 10.1161/CIRCRESAHA.116.305547. Epub 2014 Nov 21. 10.1161/CIRCRESAHA.116.305547 PubMed 25416133
Map uploaded by the depositor.
