Skip to main content
Addgene

pMx-puro-MGT
(Plasmid #111809)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111809 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMx-puromycin
  • Backbone manufacturer
    Cell biolabs
  • Backbone size w/o insert (bp) 5900
  • Total vector size (bp) 9974
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mef2c, Tbx5 and Gata4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4347
  • Entrez Gene
    Gata4 (a.k.a. Gata-4)
  • Entrez Gene
    Mef2c (a.k.a. 5430401D19Rik, 9930028G15Rik, Mef2)
  • Entrez Gene
    Tbx5
  • Promoter viral LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMx-puro-MGT was a gift from Li Qian (Addgene plasmid # 111809 ; http://n2t.net/addgene:111809 ; RRID:Addgene_111809)

  • For your References section:

    Stoichiometry of Gata4, Mef2c, and Tbx5 influences the efficiency and quality of induced cardiac myocyte reprogramming. Wang L, Liu Z, Yin C, Asfour H, Chen O, Li Y, Bursac N, Liu J, Qian L. Circ Res. 2015 Jan 16;116(2):237-44. doi: 10.1161/CIRCRESAHA.116.305547. Epub 2014 Nov 21. 10.1161/CIRCRESAHA.116.305547 PubMed 25416133
Related items:
Commonly requested with: