VEGF binding scFv G6
(Plasmid
#111716)
-
PurposeYeast Surface Display of G6 as a reference starting point for design
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCTcon2
- Backbone size w/o insert (bp) 6168
- Total vector size (bp) 6960
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameG6
-
SpeciesSynthetic
-
Insert Size (bp)792
-
Tag
/ Fusion Protein
- cmyc tag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nhe1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer GCAGCCCCATAAACACACAGTATG
- 3′ sequencing primer GGAGAAATGAAAAGTATATTGTATTTTGTA (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The amino acid sequence is taken from the deposited structure 2FJG in the protein data bank
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VEGF binding scFv G6 was a gift from Sarel Fleishman (Addgene plasmid # 111716 ; http://n2t.net/addgene:111716 ; RRID:Addgene_111716) -
For your References section:
Optimizing antibody affinity and stability by the automated design of the variable light-heavy chain interfaces. Warszawski S, Borenstein Katz A, Lipsh R, Khmelnitsky L, Ben Nissan G, Javitt G, Dym O, Unger T, Knop O, Albeck S, Diskin R, Fass D, Sharon M, Fleishman SJ. PLoS Comput Biol. 2019 Aug 23;15(8):e1007207. doi: 10.1371/journal.pcbi.1007207. eCollection 2019 Aug. 10.1371/journal.pcbi.1007207 PubMed 31442220