pMV306-ribo-APEX2
(Plasmid #111700)

• Purpose: Theophylline-inducible expression of APEX2 from a mycobacterial shuttle plasmid (integrating)
• Depositing Lab: Jessica Seeliger
• Publication: Ganapathy et al ACS Infect Dis. 2018 Apr 30. doi: 10.1021/acsinfecdis.8b00044.

Backbone

• Vector backbone: pMV306
• Total vector size (bp): 5052
• Modifications to backbone: Derivative of pMV306 in which promoter has been modified to include theophylline-inducible riboswitch. See reference: Seeliger JC, Topp S, Sogi KM, Previti ML, Gallivan JP, Bertozzi CR. A riboswitch-based inducible gene expression system for mycobacteria. PLoS ONE. 2012;7(1):e29266. PMCID: 3261144
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: APEX2
• Insert Size (bp): 801
• Promoter: hsp60-ribo
• Tag / Fusion Protein:
  • V5 (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCCTTTGAGTGAGCTGATACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Alice Ting (pcDNA3-mito-APEX, Addgene plasmid #42607)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is for theophylline-inducible expression of APEX2 in the cytoplasm of mycobacteria. It is a single-copy integrating vector in mycobacteria. The APEX gene was subcloned from pcDNA3-mito-APEX and subsequently mutated by site-directed mutagenesis to generate the optimized variant APEX2.

See also references: Rhee HW, Zou P, Udeshi ND, Martell JD, Mootha VK, Carr SA, Ting AY. Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging. Science. 2013;339(6125):1328-31. PMCID: 3916822.

Lam SS, Martell JD, Kamer KJ, Deerinck TJ, Ellisman MH, Mootha VK, Ting AY. Directed evolution of APEX2 for electron microscopy and proximity labeling. Nat Methods. 2015;12(1):51-4. PMCID: 4296904