pxCas9CR4
(Plasmid #111656)

• Purpose: PCas9CR4 with the xCas9 mutations allowing NG PAM sites
• Depositing Lab: Christopher Reisch
• Publication: pCas9CR4 with point mutations from Cas9X for NG PAM sites (unpublished)

Backbone

• Vector backbone: p15A origin
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: TetR and xCas9
• Species: Synthetic; E. coli
• Mutation: xCas9 mutations
• Tag / Fusion Protein:
  • ssrA (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cgtctcattttcgccagatatc

Resource Information

• Supplemental Documents:
  • pcas9cr4-xcas9 (1).gb
• A portion of this plasmid was derived from a plasmid made by: pdCas9 plasmid from Stanley Qi at UCSF and pCas9CR4 from Kristala Prather at MIT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry