dPTE2
(Plasmid
#111634)
-
PurposePROSS stabilized PTE S5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111634 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMal C2
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 6634
- Total vector size (bp) 1008
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedPTE2
-
Alt namePROSS stabilized PTE S5
-
SpeciesSynthetic
-
Insert Size (bp)1008
- Promoter pTac
-
Tag
/ Fusion Protein
- MBP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer GACGCGCAGACTAATTCGAGCTC
- 3′ sequencing primer TTACAACGTCGTGACTGGGAAAACCCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
dPTE2 was a gift from Sarel Fleishman (Addgene plasmid # 111634 ; http://n2t.net/addgene:111634 ; RRID:Addgene_111634) -
For your References section:
Automated Design of Efficient and Functionally Diverse Enzyme Repertoires. Khersonsky O, Lipsh R, Avizemer Z, Ashani Y, Goldsmith M, Leader H, Dym O, Rogotner S, Trudeau DL, Prilusky J, Amengual-Rigo P, Guallar V, Tawfik DS, Fleishman SJ. Mol Cell. 2018 Oct 4;72(1):178-186.e5. doi: 10.1016/j.molcel.2018.08.033. Epub 2018 Sep 27. 10.1016/j.molcel.2018.08.033 PubMed 30270109