pmCherry-EXO1a
(Plasmid #111629)

• Purpose: Expresses human WT Exonuclease 1a (EXO1a) tagged with mCherry in mammalian cells
• Depositing Lab: Marco Muzi-Falconi
• Publication: Sertic et al Proc Natl Acad Sci U S A. 2011 Aug 16;108(33):13647-52. doi: 10.1073/pnas.1108547108. Epub 2011 Aug 1.

Backbone

• Vector backbone: pmCherry-N1
• Modifications to backbone: eGFP of peGFP-N1 plasmid was substituted with mCherry
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Exonuclease 1a
• Alt name: EXO1a
• Species: H. sapiens (human)
• Insert Size (bp): 2409
• Entrez Gene: EXO1 (a.k.a. HEX1, hExoI)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: ACCAGAGTCGGGTACTGTTTCAGA
• 3′ sequencing primer: TAGTGTTCCCAAAGTGGGTGGTGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry