pT2/SV-Venus-SIINFEKL
(Plasmid #111624)

• Purpose: Sleeping Beauty transposon containing SV-40-driven Venus-LEQLE-SIINFEKL-TEW for antigen presentation studies
• Depositing Lab: Jon Yewdell
• Publication: SIINFEKL antigen presentation (unpublished)

Backbone

• Vector backbone: pT2/SV-Neo
• Backbone manufacturer: Addgene # 26553
• Total vector size (bp): 5057
• Modifications to backbone: The Neo cassette was removed and Venus was cloned via SmaI/BstBI. Then, a well-flanked SIINFEKL was cloned by PCR mutagenesis at the C-terminus of Venus. The Sleeping Beauty transposon sequences are intact.
• Vector type: Mammalian Expression
• Selectable markers: Venus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Venus-LEQLE-SIINFEKL-TEW
• Alt name: Venus-SL8
• Alt name: Venus-SIINFEKL
• Insert Size (bp): 768
• Promoter: SV40
• Tag / Fusion Protein:
  • LEQLE-SIINFEKL-TEW (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (not destroyed)
• 3′ cloning site: BstBI (not destroyed)
• 5′ sequencing primer: TATTTATGCAGAGGCCGAGG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • Coding sequence of Venus SIINFEKL open reading frame
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry