pmCherry-N1-EXO1b
(Plasmid #111621)

• Purpose: Expression of human WT Exonuclease 1 (EXO1) tagged with mCherry in mammalian cells
• Depositing Lab: Marco Muzi-Falconi
• Publication: Sertic et al Mol Cell. 2018 Apr 5;70(1):34-47.e4. doi: 10.1016/j.molcel.2018.02.017. Epub 2018 Mar 15.

Backbone

• Vector backbone: pmCherry-N1
• Modifications to backbone: eGFP of peGFP-N1 plasmid was substituted with mCherry
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Exonuclease 1b
• Alt name: EXO1
• Species: H. sapiens (human)
• Insert Size (bp): 2538
• Entrez Gene: EXO1 (a.k.a. HEX1, hExoI)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: ACCAGAGTCGGGTACTGTTTCAGA
• 3′ sequencing primer: TAGTGTTCCCAAAGTGGGTGGTGA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pmCherry-N1-EXO1b presents K589, H354, E670, R723C polymorphisms, also normally expressed in different type of cells analyzed.