33-G-X5-pEF1/V5-His
(Plasmid #111605)

• Purpose: Express human 33-G-X5 in 293T cells
• Depositing Lab: Timothy Springer
• Publication: Qin et al Cell. 2018 Jun 28;174(1):156-171.e16. doi: 10.1016/j.cell.2018.05.027. Epub 2018 Jun 14.

Backbone

• Vector backbone: pEF1/V5-His
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human LRRC33 and GARP chimeria
• Alt name: NRROS and GARP chimeria
• Species: H. sapiens (human)
• Insert Size (bp): 2000
• Entrez Gene: NRROS (a.k.a. ELLP3030, GARPL1, LRRC33, UNQ3030)
• Promoter: EF1a
• Tag / Fusion Protein:
  • Flag tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH I (not destroyed)
• 3′ cloning site: Nhe I (not destroyed)
• 5′ sequencing primer: ggatccgctagcgccaccatgtggtg
• 3′ sequencing primer: ctagagcggccgctttaGGCTTTAT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry