plexm-mouse LRRC33
(Plasmid #111601)

• Purpose: Express mouse LRRC33 in 293T cells
• Depositing Lab: Timothy Springer
• Publication: Qin et al Cell. 2018 Jun 28;174(1):156-171.e16. doi: 10.1016/j.cell.2018.05.027. Epub 2018 Jun 14.

Backbone

• Vector backbone: plexm
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 6500
• Vector type: Mammalian Expression
• Selectable markers: N/A

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mouse LRRC33
• Alt name: NRROS
• Species: M. musculus (mouse)
• Insert Size (bp): 2000
• Mutation: Starts at aa 18
• Entrez Gene: Nrros (a.k.a. E430025L02Rik, Lrcc33, Lrrc33)
• Tag / Fusion Protein:
  • FLAG (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (destroyed during cloning)
• 3′ cloning site: Sal I (destroyed during cloning)
• 5′ sequencing primer: ATGGAGTTCCCGCCCCTCTGGC
• 3′ sequencing primer: TCAGTATATGGAGGACCAGTGGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry