Skip to main content
Addgene

plexm-human LRRC33
(Plasmid #111600)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111600 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    plexm
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression
  • Selectable markers
    N/A

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LRRC33
  • Alt name
    NRROS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Entrez Gene
    NRROS (a.k.a. ELLP3030, GARPL1, LRRC33, UNQ3030)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site AgeI (unknown if destroyed)
  • 5′ sequencing primer tggaggaacagaagcggaacag
  • 3′ sequencing primer tcagtaaacggaggaccagtggca
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The PlexM plasmid was kindly provided by Dr. Radu Aricescu, University of Oxford

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plexm-human LRRC33 was a gift from Timothy Springer (Addgene plasmid # 111600 ; http://n2t.net/addgene:111600 ; RRID:Addgene_111600)

  • For your References section:

    A Milieu Molecule for TGF-beta Required for Microglia Function in the Nervous System. Qin Y, Garrison BS, Ma W, Wang R, Jiang A, Li J, Mistry M, Bronson RT, Santoro D, Franco C, Robinton DA, Stevens B, Rossi DJ, Lu C, Springer TA. Cell. 2018 Jun 28;174(1):156-171.e16. doi: 10.1016/j.cell.2018.05.027. Epub 2018 Jun 14. 10.1016/j.cell.2018.05.027 PubMed 29909984
Related items:
Commonly requested with: