pACEBac1-PARP2-Flag-His-WT
(Plasmid #111574)

• Purpose: Expresses full length PARP2 in Sf9 (insect) cells
• Depositing Lab: Thomas Muir
• Publication: Liszczak et al Nat Chem Biol. 2018 Jul 16. pii: 10.1038/s41589-018-0097-1. doi: 10.1038/s41589-018-0097-1.

Backbone

• Vector backbone: pACEBac1
• Modifications to backbone: C-terminal Flag-6xHis
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PARP2
• Alt name: Poly(ADP-ribose) polymerase 2
• Alt name: ARTD2
• Species: H. sapiens (human)
• Insert Size (bp): 1749
• Entrez Gene: PARP2 (a.k.a. ADPRT2, ADPRTL2, ADPRTL3, ARTD2, PARP-2, pADPRT-2)
• Promoter: polyhedrin promoter
• Tags / Fusion Proteins:
  • C-terminal 6xHis (C terminal on backbone)
  • C-terminal Flag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: Custom (gtatcgattcgcgacctactcc)
• 3′ sequencing primer: SV40pA-R

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry