pACEBac1-PARP1-Flag-His-7xKQ
(Plasmid #111573)

• Purpose: Expresses full length PARP1 with K to Q mutations in automodification domain in Sf9 (insect) cells
• Depositing Lab: Thomas Muir
• Publication: Liszczak et al Nat Chem Biol. 2018 Jul 16. pii: 10.1038/s41589-018-0097-1. doi: 10.1038/s41589-018-0097-1.

Backbone

• Vector backbone: pACEBac1
• Modifications to backbone: C-terminal Flag-6xHis
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: PARP1
• Alt name: Poly(ADP-ribose) polymerase 1
• Alt name: ARTD1
• Species: H. sapiens (human)
• Insert Size (bp): 3042
• Mutation: lysine to glutamine mutation at the following amino acids: 498, 505, 506, 508, 518, 521, 524
• Entrez Gene: PARP1 (a.k.a. ADPRT, ADPRT 1, ADPRT1, ARTD1, PARP, PARP-1, PARS, PPOL, Poly-PARP, pADPRT-1)
• Promoter: polyhedrin promoter
• Tags / Fusion Proteins:
  • C-terminal 6xHis (C terminal on backbone)
  • C-terminal Flag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (on insert), BamHI (in vector) (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: Custom (gtatcgattcgcgacctactcc)
• 3′ sequencing primer: SV40pA-R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry