pScaf-5544.3
(Plasmid
#111523)
-
PurposepScaf phagemid with insert for generating DNA origami scaffold 5544 bases in length (v3)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepScaf
- Backbone size w/o insert (bp) 3154
- Total vector size (bp) 8299
-
Modifications to backboneSequence inserted between KpnI/BamHI restriction sites
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions37°C for plasmid growth, 30°C for phagemid ssDNA preparation (if transformed into HFR/F+/F' strain)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepScaf-H'I
-
Insert Size (bp)5163
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAAGGGATTTTGCCGATTTC
- 3′ sequencing primer CACAGGAAACAGCTATGACCATGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Preprint available at https://www.biorxiv.org/content/early/2018/04/27/309682
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScaf-5544.3 was a gift from Shawn Douglas (Addgene plasmid # 111523 ; http://n2t.net/addgene:111523 ; RRID:Addgene_111523) -
For your References section:
Construction of a novel phagemid to produce custom DNA origami scaffolds. Nafisi PM, Aksel T, Douglas SM. Synth Biol (Oxf). 2018 Jan;3(1). doi: 10.1093/synbio/ysy015. Epub 2018 Aug 9. 10.1093/synbio/ysy015 PubMed 30984875