pCS6-StaPLd-Casp9
(Plasmid #111511)

• Purpose: Expresses a tandem caspase-9 dimer, governed by a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].
• Depositing Lab: Michael Lin
• Publication: Jacobs et al Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2.

Backbone

• Vector backbone: pCMV-SPORT6
• Backbone manufacturer: Invitrogen
• Total vector size (bp): 6801
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: StaPLd-Casp9
• Species: H. sapiens (human); Hepatitis C Virus (HCV) genotype 1a
• Insert Size (bp): 2457
• Mutation: The HCV NS3 protease carries V36M, T54A, and S122G mutations. Both caspase-9 copies have had their N termini truncated.
• GenBank ID: NC_004102
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACAGCTATGACCATTAGGCCT
• 3′ sequencing primer: GTTGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pCS6-StaPLd-Casp9.gb
• A portion of this plasmid was derived from a plasmid made by: the Guy Salvesen lab [Caspase-9, Ref. 1]

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

[Ref. 1]
STENNICKE H.R., DEVERAUX Q.L., HUMKE E.W., REED J.C., DIXIT V.M. & SALVESEN G.S. 1999. Caspase-9 can be activated without proteolytic processing. J Biol Chem 274: 8359-8362.