pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR
(Plasmid #111502)

• Purpose: Expresses a zinc finger specific to the human VEGFA locus, which is linked to a VPR transcriptional activation domain via a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].
• Depositing Lab: Michael Lin
• Publication: Jacobs et al Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2.

Backbone

• Vector backbone: pCMV-SPORT6
• Backbone manufacturer: Invitrogen
• Total vector size (bp): 7834
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: ZF(VEGFA)-StaPL(AI)-YFP-VPR
• Species: H. sapiens (human); Hepatitis C Virus (HCV) genotype 1a, Aequorea victoria, Herpes simplex virus, Epstein-Barr virus
• Insert Size (bp): 3468
• Mutation: The HCV NS3 protease carries V36M, T54A, and S122G mutations. The VPR domain's internal NLS sequence was mutated to a GGSGGS linker.
• GenBank ID: NC_004102
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ACAGCTATGACCATTAGGCCT
• 3′ sequencing primer: GTTGTAAAACGACGGCCAGT

Resource Information

• Supplemental Documents:
  • pCS6-ZF(VEGFA)-StaPL(AI)-YFP-VPR.gb
• A portion of this plasmid was derived from a plasmid made by: the Atsushi Miyawaki lab [Venus YFP, Ref. 1], and the George Church lab [VPR, Ref. 2].

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

[Ref. 1]
NAGAI T., IBATA K., PARK E.S., KUBOTA M., MIKOSHIBA K. & MIYAWAKI A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20: 87-90.

[Ref. 2]
CHAVEZ A., SCHEIMAN J., VORA S., PRUITT B.W., TUTTLE M., P R IYER E., LIN S., KIANI S., GUZMAN C.D., WIEGAND D.J., TER-OVANESYAN D., BRAFF J.L., DAVIDSOHN N., HOUSDEN B.E., PERRIMON N., WEISS R., AACH J., COLLINS J.J. & CHURCH G.M. 2015. Highly efficient Cas9-mediated transcriptional programming. Nat Methods 12: 326-328.