pCS6-YFP-SMASh(TI)
(Plasmid #111501)

• Purpose: Expresses Venus YFP with a C-terminal SMASh(TI) tag fusion in mammalian cells. [TI = telaprevir inhibited].
• Depositing Lab: Michael Lin
• Publication: Jacobs et al Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2.

Backbone

• Vector backbone: pCMV-SPORT6
• Backbone manufacturer: Invitrogen
• Total vector size (bp): 8340
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: YFP-SMASh(TI)
• Species: Aequorea victoria, Hepatitis C Virus (HCV) genotype 1a
• Insert Size (bp): 1758
• Mutation: The HCV NS3 protease carries F43L, Q80K, S122R, and D168Y mutations.
• GenBank ID: NC_004102
• Promoter: CMV
• Tags / Fusion Proteins:
  • SMASh tag (C terminal on insert)
  • HA epitope tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTTAGGTGACACTATAG
• 3′ sequencing primer: CCTAGTTGGCAAAAGCCACA

Resource Information

• Supplemental Documents:
  • pCS6-YFP-SMASh(TI).gb
• A portion of this plasmid was derived from a plasmid made by: the Michael Lin lab [SMASh tag, Ref. 1], and the Atsushi Miyawaki lab [Venus YFP, Ref. 2].

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

[Ref. 1]
CHUNG H.K., JACOBS C.L., HUO Y., YANG J., KRUMM S.A., PLEMPER R.K., TSIEN R.Y. & LIN M.Z. 2015. Tunable and reversible drug control of protein production via a self-excising degron. Nat Chem Biol 11: 713-720.

[Ref. 2]
NAGAI T., IBATA K., PARK E.S., KUBOTA M., MIKOSHIBA K. & MIYAWAKI A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20: 87-90.