Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCS6-YFP-SMASh(AI)
(Plasmid #111500)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111500 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV-SPORT6
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 8340
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    YFP-SMASh(AI)
  • Species
    Aequorea victoria, Hepatitis C Virus (HCV) genotype 1a
  • Insert Size (bp)
    1758
  • Mutation
    The HCV NS3 protease carries V36M, T54A, and S122G mutations.
  • GenBank ID
    NC_004102
  • Promoter CMV
  • Tags / Fusion Proteins
    • SMASh tag (C terminal on insert)
    • HA epitope tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer CCTAGTTGGCAAAAGCCACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    the Michael Lin lab [SMASh tag, Ref. 1], and the Atsushi Miyawaki lab [Venus YFP, Ref. 2].
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

[Ref. 1]
CHUNG H.K., JACOBS C.L., HUO Y., YANG J., KRUMM S.A., PLEMPER R.K., TSIEN R.Y. & LIN M.Z. 2015. Tunable and reversible drug control of protein production via a self-excising degron. Nat Chem Biol 11: 713-720.

[Ref. 2]
NAGAI T., IBATA K., PARK E.S., KUBOTA M., MIKOSHIBA K. & MIYAWAKI A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20: 87-90.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS6-YFP-SMASh(AI) was a gift from Michael Lin (Addgene plasmid # 111500 ; http://n2t.net/addgene:111500 ; RRID:Addgene_111500)
  • For your References section:

    StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496