Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pScaf-10080.1
(Plasmid #111410)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111410 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pScaf
  • Backbone size w/o insert (bp) 3154
  • Total vector size (bp) 12835
  • Modifications to backbone
    Sequence inserted between KpnI/BamHI restriction sites
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    37°C for plasmid growth, 30°C for phagemid ssDNA preparation (if transformed into HFR/F+/F' strain)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pScaf-ACKN
  • Insert Size (bp)
    9699

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAAGGGATTTTGCCGATTTC
  • 3′ sequencing primer CACAGGAAACAGCTATGACCATGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScaf-10080.1 was a gift from Shawn Douglas (Addgene plasmid # 111410 ; http://n2t.net/addgene:111410 ; RRID:Addgene_111410)
  • For your References section:

    Construction of a novel phagemid to produce custom DNA origami scaffolds. Nafisi PM, Aksel T, Douglas SM. Synth Biol (Oxf). 2018 Jan;3(1). doi: 10.1093/synbio/ysy015. Epub 2018 Aug 9. 10.1093/synbio/ysy015 PubMed 30984875