Skip to main content
Addgene

pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL
(Plasmid #111394)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111394 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4126
  • Total vector size (bp) 6615
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    hCAR
  • Alt name
    human CAR variant 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1095
  • GenBank ID
    NM_001338
  • Entrez Gene
    CXADR (a.k.a. CAR, CAR4/6, HCAR)
  • Promoter hSynapsin
  • Tag / Fusion Protein
    • Myc (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer CCAAATTGCGCATCCCCTATC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GCaMP6f
  • Alt name
    GCaMP6 fast
  • Species
    Synthetic
  • Insert Size (bp)
    1350
  • Promoter hSynapsin
  • Tags / Fusion Proteins
    • 6xHis (N terminal on insert)
    • T7 (N terminal on insert)
    • Xpress (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer AAAAGCTCCTGGTGTTGC
  • 3′ sequencing primer GCAGCGTATCCACATAGCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Backbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968); W3SL cassette comes from plasmid pAAV-CW3SL-EGFP (Addgene, Plasmid #61463).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL was a gift from Adam Kepecs (Addgene plasmid # 111394 ; http://n2t.net/addgene:111394 ; RRID:Addgene_111394)
  • For your References section:

    A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons. Li SJ, Vaughan A, Sturgill JF, Kepecs A. Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028. 10.1016/j.neuron.2018.05.028 PubMed 29879392