pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL
(Plasmid
#111394)
-
PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON GCaMP6f (ultrasensitive calcium sensor), and W3SL regulatory cassette (for maximize cloning capacity)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4126
- Total vector size (bp) 6615
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehCAR
-
Alt namehuman CAR variant 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1095
-
GenBank IDNM_001338
-
Entrez GeneCXADR (a.k.a. CAR, CAR4/6, HCAR)
- Promoter hSynapsin
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer CCAAATTGCGCATCCCCTATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGCaMP6f
-
Alt nameGCaMP6 fast
-
SpeciesSynthetic
-
Insert Size (bp)1350
- Promoter hSynapsin
-
Tags
/ Fusion Proteins
- 6xHis (N terminal on insert)
- T7 (N terminal on insert)
- Xpress (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer AAAAGCTCCTGGTGTTGC
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBackbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968); W3SL cassette comes from plasmid pAAV-CW3SL-EGFP (Addgene, Plasmid #61463).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO {hCAR}off-{GCaMP6f}on-W3SL was a gift from Adam Kepecs (Addgene plasmid # 111394 ; http://n2t.net/addgene:111394 ; RRID:Addgene_111394) -
For your References section:
A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons. Li SJ, Vaughan A, Sturgill JF, Kepecs A. Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028. 10.1016/j.neuron.2018.05.028 PubMed 29879392