pAAV-hSyn-DIO {mCAR}off-{GCaMP6f}on-WPRE
(Plasmid #111393)

• Purpose: AAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection) and Cre-ON GCaMP6f (ultrasensitive calcium sensor)
• Depositing Lab: Adam Kepecs
• Publication: Li et al Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4836
• Total vector size (bp): 6615
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mCAR
• Alt name: mouse CAR variant 2
• Species: M. musculus (mouse)
• Insert Size (bp): 1056
• GenBank ID: NM_009988
• Entrez Gene: Cxadr (a.k.a. 2610206D03Rik, CAR, MCAR, MCVADR)
• Promoter: hSynapsin
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: CCAAATTGCGCATCCCCTATC

Gene/Insert 2

• Gene/Insert name: GCaMP6f
• Alt name: GCaMP6 fast
• Species: Synthetic
• Insert Size (bp): 1350
• Promoter: hSynapsin
• Tags / Fusion Proteins:
  • 6xHis (N terminal on insert)
  • T7 (N terminal on insert)
  • Xpress (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: SpeI (destroyed during cloning)
• 5′ sequencing primer: CATGGCTGGCAGAAATGACG
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• Supplemental Documents:
  • S18-pAAV-hSynDIO-mCarMyc_f-GCamp6f_r.gb
• A portion of this plasmid was derived from a plasmid made by: Backbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry