pAAV-hSyn-DIO {ChETA-mRuby2}on-W3SL
(Plasmid #111389)

• Purpose: AAV vector with hSynapsin promoter, Cre-ON ChETA-mRuby2 (for optogenetic activation), and W3SL regulatory cassette (for maximize cloning capacity)
• Depositing Lab: Adam Kepecs
• Publication: Li et al Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4116
• Total vector size (bp): 5769
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ChETA-mRuby2
• Alt name: hChR2(E123T/H134R)-mRuby2
• Species: Synthetic
• Insert Size (bp): 1653
• GenBank ID:
• Promoter: hSynapsin
• Tag / Fusion Protein:
  • mRuby2 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CCAAATTGCGCATCCCCTATC
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Gene/Insert 2

• Gene/Insert name: W3SL
• Species: Synthetic
• Insert Size (bp): 427
• Mutation: W3SL is built from a shortened WPRE, an upstream element and SV40 late polyadenylation signal (Choi et al., 2014). This W3SL cassette allows 0.7 kb additional cloning capacity and shows comparable expression efficiency with conventional WPRE-polyA cassettes.

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: PciI (not destroyed)
• 5′ sequencing primer: tgttgctccttttacgctatg
• 3′ sequencing primer: CCAGTTTGGAACAAGAGTCCAC

Resource Information

• Supplemental Documents:
  • S15-pAAV-hSynDIO-ChetamRuby-W3SL.gb
• A portion of this plasmid was derived from a plasmid made by: Backbone comes from plasmid pAAV-Ef1a-DIO-{ChETA-EYFP} (Addgene, Plasmid #26968); W3SL cassette comes from plasmid pAAV-CW3SL-EGFP (Addgene, Plasmid #61463).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry