pAAV-hSyn-DIO {hCAR}off-{ChETA}on-WPRE
(Plasmid #111388)

• Purpose: AAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection) and Cre-ON ChETA (for optogenetic activation)
• Depositing Lab: Adam Kepecs
• Publication: Li et al Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4832
• Total vector size (bp): 6936
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: hCAR
• Alt name: human CAR variant 1
• Species: H. sapiens (human)
• Insert Size (bp): 1095
• GenBank ID: NM_001338
• Entrez Gene: CXADR (a.k.a. CAR, CAR4/6, HCAR)
• Promoter: hSynapsin
• Tag / Fusion Protein:
  • Myc (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: CCAAATTGCGCATCCCCTATC

Gene/Insert 2

• Gene/Insert name: ChETA
• Alt name: hChR2(E123T/H134R)
• Species: Synthetic
• Insert Size (bp): 962
• Promoter: hSynapsin
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: PacI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: AAAAGCTCCTGGTGTTGC
• 3′ sequencing primer: GCAGCGTATCCACATAGCG

Resource Information

• Supplemental Documents:
  • S7-pAAV_hSyn_dio-hCARmyc_f-ChetaHA_r-.gb
• A portion of this plasmid was derived from a plasmid made by: pAAV-Ef1a-DIO-{ChETA-EYFP} vector from Deisseroth Lab (Addgene, Plasmid #26968)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry