pAAV-hSyn-DIO {ChETA}on-WPRE
(Plasmid
#111386)
-
PurposeAAV expression of ChETA (hChR2 with E123T/H134R mutations) fused to HA tag driven by hSynapsin promoter in Cre-ON manner for optogenetic activation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111386 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4836
- Total vector size (bp) 5798
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChETA
-
Alt namehChR2(E123T/H134R)
-
SpeciesSynthetic
-
Insert Size (bp)962
-
Mutationhumanized ChR2, E123T/H134R
- Promoter hSynapsin
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (destroyed during cloning)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CCAAATTGCGCATCCCCTATC
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypAAV-Ef1a-DIO-{ChETA-EYFP} vector from Deisseroth Lab (Addgene, Plasmid #26968)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO {ChETA}on-WPRE was a gift from Adam Kepecs (Addgene plasmid # 111386 ; http://n2t.net/addgene:111386 ; RRID:Addgene_111386) -
For your References section:
A Viral Receptor Complementation Strategy to Overcome CAV-2 Tropism for Efficient Retrograde Targeting of Neurons. Li SJ, Vaughan A, Sturgill JF, Kepecs A. Neuron. 2018 Jun 6;98(5):905-917.e5. doi: 10.1016/j.neuron.2018.05.028. 10.1016/j.neuron.2018.05.028 PubMed 29879392