MsCLYBL_sgRNA6
(Plasmid
#111295)
-
PurposeCRISPR KO murine CLYBL
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111295 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesgRNA6 against murine CLYBL
-
gRNA/shRNA sequenceCATAGAGCACTGCTCTCCGG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MsCLYBL_sgRNA6 was a gift from Vamsi Mootha (Addgene plasmid # 111295 ; http://n2t.net/addgene:111295 ; RRID:Addgene_111295) -
For your References section:
The Human Knockout Gene CLYBL Connects Itaconate to Vitamin B12. Shen H, Campanello GC, Flicker D, Grabarek Z, Hu J, Luo C, Banerjee R, Mootha VK. Cell. 2017 Nov 2;171(4):771-782.e11. doi: 10.1016/j.cell.2017.09.051. Epub 2017 Oct 19. 10.1016/j.cell.2017.09.051 PubMed 29056341