Skip to main content
Addgene

pLXI_TRC403 SMARCB1 var 2
(Plasmid #111185)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111185 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLXI_TRC401
  • Backbone manufacturer
    Broad Institute
  • Backbone size w/o insert (bp) 9354
  • Total vector size (bp) 10484
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    BAF47
  • Alt name
    INI1
  • Alt name
    BAF47
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1130
  • GenBank ID
    NM_001007468.2 NM_001007468.2
  • Entrez Gene
    SMARCB1 (a.k.a. BAF47, CSS3, INI-1, INI1, MRD15, PPP1R144, RDT, RTPS1, SNF5, SNF5L1, SWNTS1, Sfh1p, Snr1, hSNFS)
  • Promoter TRE
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TCGAGGTAGGCGTGTACGGTG
  • 3′ sequencing primer GACGTGAAGAATGTGCGAGAC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLXI_TRC403 SMARCB1 var 2 was a gift from William Hahn (Addgene plasmid # 111185 ; http://n2t.net/addgene:111185 ; RRID:Addgene_111185)

  • For your References section:

    Renal medullary carcinomas depend upon SMARCB1 loss and are sensitive to proteasome inhibition. Hong AL, Tseng YY, Wala JA, Kim WJ, Kynnap BD, Doshi MB, Kugener G, Sandoval GJ, Howard TP, Li J, Yang X, Tillgren M, Ghandi M, Sayeed A, Deasy R, Ward A, McSteen B, Labella KM, Keskula P, Tracy A, Connor C, Clinton CM, Church AJ, Crompton BD, Janeway KA, Van Hare B, Sandak D, Gjoerup O, Bandopadhayay P, Clemons PA, Schreiber SL, Root DE, Gokhale PC, Chi SN, Mullen EA, Roberts CW, Kadoch C, Beroukhim R, Ligon KL, Boehm JS, Hahn WC. Elife. 2019 Mar 12;8. pii: 44161. doi: 10.7554/eLife.44161. 10.7554/eLife.44161 PubMed 30860482
Related items:
Commonly requested with: