pPICZc-ScAct1*-thymosinB-8His
(Plasmid #111148)

• Purpose: Expresses Saccharomyces cerevisiae Act1 (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag. TH3-37
• Depositing Lab: Mohan Balasubramanian
• Publication: Hatano et al J Cell Sci. 2018 Mar 13. pii: jcs.213827. doi: 10.1242/jcs.213827.

Backbone

• Vector backbone: pPICZc
• Backbone manufacturer: Invitrogen
• Vector type: Yeast Expression ; Pichia pastoris integration plasmid
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Use LB low salt
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Act1
• Alt name: Yeast actin
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1125
• Entrez Gene: ACT1 (a.k.a. YFL039C, ABY1, END7)
• Promoter: AOX1
• Tag / Fusion Protein:
  • Thymosin beta and a His-tag (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: GACTGGTTCCAATTGACAAGC
• 3′ sequencing primer: GCAAATGGCATTCTGACATCC

Resource Information

• Supplemental Documents:
  • ScACT1-thymosinbeta-8His.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry