pCT310
(Plasmid #111140)

• Purpose: Bacterial expression of 6His-dCas9-3XFlag
• Depositing Lab: Robert Tjian
• Publication: Tsui et al Proc Natl Acad Sci U S A. 2018 Mar 20;115(12):E2734-E2741. doi: 10.1073/pnas.1718844115. Epub 2018 Mar 5.

Backbone

• Vector backbone: pET302/NT-His
• Backbone manufacturer: Thermo Fisher (Invitrogen)
• Backbone size w/o insert (bp): 5712
• Total vector size (bp): 9949
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: dCas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4101
• Mutation: D10A - H840A
• Promoter: T7
• Tags / Fusion Proteins:
  • 6X His (N terminal on insert)
  • 3X Flag (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: 5'_pET / CGATCCCGCGAAATTAATACGA
• 3′ sequencing primer: pFN Flexi REVseq / CTTTCGGGCTTTGTTAGCAG

Resource Information

• Supplemental Documents:
  • pCT310.gb
• A portion of this plasmid was derived from a plasmid made by: Frank Xie, Tjian Lab - Introduced D10A and H840A mutations to wild type SpCas9 (gift of the Doudna Lab)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry