pSEMS-Tom20-Halo7Tag
(Plasmid #111135)

• Purpose: Tom20 with selflabeling tag, e.g. for fluorescence microscopy
• Depositing Lab: Karin Busch
• Publication: Appelhans et al Nano Lett. 2012 Feb 8;12(2):610-6. doi: 10.1021/nl203343a. Epub 2012 Jan 13.

Backbone

• Vector backbone: pSEMS(26m)
• Backbone manufacturer: Covalys, NEB
• Backbone size w/o insert (bp): 5325
• Total vector size (bp): 6570
• Modifications to backbone: original snap-Tag substituted by Halo7-Tag
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Receptor of tranlocase of outer mitochondrial membrane Tom20
• Alt name: Tom20
• Species: H. sapiens (human)
• Insert Size (bp): 435
• Entrez Gene: TOMM20 (a.k.a. MAS20, MOM19, TOM20)
• Promoter: CMV
• Tag / Fusion Protein:
  • Halo7 Tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGGTGGGTCGGAACAGCGCCAT
• 3′ sequencing primer: TTCCACATCATCTTCAGCCAAG

Resource Information

• Supplemental Documents:
  • Tom20-Halo7.gb
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry