pFUGW-RapACR-EYFP
(Plasmid
#111075)
-
PurposeFast anion channelrhodopsin (current half-decay time 3-10 ms depending on voltage and light intensity) for time-resolved inhibition of neuronal spiking
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 111075 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUGW
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAnion channelrhodopsin RapACR
-
SpeciesRhodomonas salina
-
Insert Size (bp)921
-
GenBank IDMG831192
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGAACTATGCGCTCGGGGTTGGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUGW-RapACR-EYFP was a gift from John Spudich (Addgene plasmid # 111075 ; http://n2t.net/addgene:111075 ; RRID:Addgene_111075) -
For your References section:
Extending the Time Domain of Neuronal Silencing with Cryptophyte Anion Channelrhodopsins. Govorunova EG, Sineshchekov OA, Hemmati R, Janz R, Morelle O, Melkonian M, Wong GK, Spudich JL. eNeuro. 2018 Jul 10;5(3). pii: eN-MNT-0174-18. doi: 10.1523/ENEURO.0174-18.2018. eCollection 2018 May-Jun. 10.1523/ENEURO.0174-18.2018 PubMed 30027111