pmTurquoise-parkin
(Plasmid #110945)

• Purpose: Expresses the ubiquitin ligase parkin fused to mTurquoise
• Depositing Lab: Pablo Rivera-Fuentes
• Publication: Nguyen et al Org Biomol Chem. 2021 Mar 28;19(12):2681-2687. doi: 10.1039/d0ob02259d. Epub 2021 Feb 26.

Backbone

• Vector backbone: pECFP-C1
• Backbone size w/o insert (bp): 4698
• Total vector size (bp): 6096
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E3 ubiquitin ligase parkin
• Alt name: parkin
• Species: H. sapiens (human)
• Insert Size (bp): 2009
• Entrez Gene: PRKN (a.k.a. AR-JP, LPRS2, PARK2, PDJ)
• Promoter: CMV
• Tag / Fusion Protein:
  • mTurquoise2

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AGAAGCGCGATCACATGG
• 3′ sequencing primer: CAGCCATACCACATTTGTAG

Resource Information

• Supplemental Documents:
  • pmTurquoise2-Parkin-assembled.gb
• A portion of this plasmid was derived from a plasmid made by: This plasmid was assembled using fragments from plasmids #47560 (backbone) and #36204 (mTurquoise2 insert).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry