pUG-natNT2
(Plasmid #110922)

• Purpose: expression of nat gene conferring resistance to nourseothricin for gene deletion in yeast
• Depositing Lab: Jean-Marc Daran
• Publication: Juergens et al FEMS Yeast Res. 2018 May 1;18(3). pii: 4847887. doi: 10.1093/femsyr/foy012.

Backbone

• Vector backbone: pUG6
• Backbone manufacturer: Gueldener et al Nucleic Acid Res 30(6):e23. 11884642
• Backbone size w/o insert (bp): 4009
• Total vector size (bp): 3852
• Modifications to backbone: The natNT2 marker was cloned from pFA6a-natNT2 (Janke et al., 2004) to pUG6 via the SacI and BglII restriction sites, thereby replacing the KanMX4 marker, resulting inpUG-natNT2.
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: nourseothricin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nat
• Species: Streptomyces noursei
• Insert Size (bp): 576
• GenBank ID: ABB59019.1
• Promoter: AgTEF1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: CCAGCTGAAGCTTCGTACGC
• 3′ sequencing primer: GCATAGGCCACTAGTGGATCTG

Resource Information

• Supplemental Documents:
  • pUG-natN.gb
• A portion of this plasmid was derived from a plasmid made by: Janke C, Magiera MM, Rathfelder N, Taxis C, Reber S, Maekawa H, Moreno-Borchart A, Doenges G, Schwob E, Schiebel E, Knop M. A versatile toolbox for PCR-based tagging of yeast genes: new fluorescent proteins, more markers and promoter substitution cassettes. Yeast. 2004 Aug;21(11):947-62.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry