Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

plko-tet-on puromycin-shMTH1
(Plasmid #110918)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110918 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO-Tet-on (puromycin)
  • Backbone manufacturer
    PUBMED ID: 19177017
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MTH1
  • gRNA/shRNA sequence
    GAAATTCCACGGGTACTTCAA
  • Species
    H. sapiens (human)
  • Entrez Gene
    NUDT1 (a.k.a. MTH1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • 3′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Rai lab uses XL-10 gold ultracompetent cells as the growth strain, but DH5alpha should work fine too

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    plko-tet-on puromycin-shMTH1 was a gift from Priyamvada Rai (Addgene plasmid # 110918 ; http://n2t.net/addgene:110918 ; RRID:Addgene_110918)
  • For your References section:

    MutT Homolog 1 (MTH1) maintains multiple KRAS-driven pro-malignant pathways. Patel A, Burton DG, Halvorsen K, Balkan W, Reiner T, Perez-Stable C, Cohen A, Munoz A, Giribaldi MG, Singh S, Robbins DJ, Nguyen DM, Rai P. Oncogene. 2015 May 14;34(20):2586-96. doi: 10.1038/onc.2014.195. Epub 2014 Jul 14. 10.1038/onc.2014.195 PubMed 25023700