pCZGY553
(Plasmid #110883)

• Purpose: Pmec-4 Gateway Destination vector for cloning for expression in C. elegans mechanosensory neurons
• Depositing Lab: Andrew Chisholm
• Publication: Ghosh-Roy et al J Neurosci. 2010 Mar 3;30(9):3175-83. doi: 10.1523/JNEUROSCI.5464-09.2010.

Backbone

• Vector backbone: Gateway Destination Vector
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5020
• Total vector size (bp): 6135
• Vector type: Gateway Destination Vector

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Pmec-4
• Alt name: mec-4 promoter
• Species: C. elegans (nematode)
• Insert Size (bp): 1025

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: CAGGAAACAGCTATGACCATG
• 3′ sequencing primer: AAACTTGTGATGTACCGTCG

Resource Information

• Supplemental Documents:
  • mec4-5intron-GWY-pcZGY553.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry