-
PurposeLentiviral vector for constitutive expression of Cas9-HF1RA-P2A-GFP in mammalian cells (codon optimized)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 110866 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAdapted from lentiCRISPRv1
- Backbone size w/o insert (bp) 6296
-
Vector typeLentiviral
-
Selectable markersPuromycin ; GFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas9-HF1RA
-
Alt nameHF1RA
-
SpeciesSynthetic
-
Insert Size (bp)4227
-
MutationR661A, Q695A, Q926A, and NLS sequence at the N-terminus
- Promoter EF1s
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAAGTGCAGTAGTCGCCGTG
- 3′ sequencing primer TTAAGAATACCAGTCAATCTTTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-HF1RA-P2A-GFP-PGK-Puro was a gift from Lukas Dow (Addgene plasmid # 110866 ; http://n2t.net/addgene:110866 ; RRID:Addgene_110866) -
For your References section:
Optimized base editors enable efficient editing in cells, organoids and mice. Zafra MP, Schatoff EM, Katti A, Foronda M, Breinig M, Schweitzer AY, Simon A, Han T, Goswami S, Montgomery E, Thibado J, Kastenhuber ER, Sanchez-Rivera FJ, Shi J, Vakoc CR, Lowe SW, Tschaharganeh DF, Dow LE. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. 10.1038/nbt.4194 PubMed 29969439