pRP(Exp)-CMV> :dTomato:IRES:Puro
(Plasmid #110832)

• Purpose: Expresses dTomato (dT) red fluorescent reporter.
• Depositing Lab: Ande Satyanarayana
• Publication: Elattar et al FASEB J. 2018 Mar 23:fj201701465RR. doi: 10.1096/fj.201701465RR.

Backbone

• Vector backbone: pUC19
• Backbone manufacturer: vector builder
• Backbone size w/o insert (bp): 4726
• Total vector size (bp): 5671
• Vector type: non-viral gene expression vector
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dTomato Tag
• Alt name: dT
• Insert Size (bp): 945
• Promoter: CMV
• Tag / Fusion Protein:
  • IRES (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: dTomato-reverse primer: CCTCGCCCTTGCTCACCAT
• 3′ sequencing primer: CMV-forward primer: TTGACGCAAATGGGCGGTAGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: vector builder

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry