pRP(Exp)-CMV> ORF_924bp (Azgp1):dTomato:IRES:Puro
(Plasmid #110831)

• Purpose: Expresses both zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter, where the fluorescent dT reporter is fused with the ZAG protein.
• Depositing Lab: Ande Satyanarayana
• Publication: Elattar et al FASEB J. 2018 Mar 23:fj201701465RR. doi: 10.1096/fj.201701465RR.

Backbone

• Vector backbone: pUC19
• Backbone manufacturer: vector builder
• Backbone size w/o insert (bp): 5668
• Total vector size (bp): 6592
• Vector type: non-viral gene expression vector
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Azgp1
• Alt name: ZAG-dT
• Species: M. musculus (mouse)
• Insert Size (bp): 924
• Entrez Gene: Azgp1 (a.k.a. Zag)
• Promoter: CMV
• Tag / Fusion Protein:
  • dTomato (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: ORF_924bp (Azgp1)-reverse primer: CTGAGGCTGAGCTACAACATTG
• 3′ sequencing primer: CMV-forward primer: TTGACGCAAATGGGCGGTAGG

Resource Information

• Supplemental Documents:
  • Vector report
• A portion of this plasmid was derived from a plasmid made by: vector builder

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry