Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET27b-ecDHFR-N23PP/S148A
(Plasmid #110829)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110829 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pET27b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5414
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ecDHFR
  • Alt name
    dihydrofolate reductase
  • Alt name
    folA
  • Species
    E.coli
  • Insert Size (bp)
    483
  • Mutation
    N23 mutated to P23; a proline residue inserted between residues 23 and 24 of wild-type ecDHFR; S148 mutated to A148
  • Promoter T7

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET27b-ecDHFR-N23PP/S148A was a gift from Stephen Benkovic (Addgene plasmid # 110829 ; http://n2t.net/addgene:110829 ; RRID:Addgene_110829)
  • For your References section:

    A dynamic knockout reveals that conformational fluctuations influence the chemical step of enzyme catalysis. Bhabha G, Lee J, Ekiert DC, Gam J, Wilson IA, Dyson HJ, Benkovic SJ, Wright PE. Science. 2011 Apr 8;332(6026):234-8. doi: 10.1126/science.1198542. 10.1126/science.1198542 PubMed 21474759