pET27b-ecDHFR-N23PP
(Plasmid #110828)

• Purpose: Bacterial expression of E.coli DHFR N23PP mutant
• Depositing Lab: Stephen Benkovic
• Publication: Bhabha et al Science. 2011 Apr 8;332(6026):234-8. doi: 10.1126/science.1198542.

Backbone

• Vector backbone: pET27b
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5414
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ecDHFR
• Alt name: dihydrofolate reductase
• Alt name: folA
• Species: E.coli
• Insert Size (bp): 483
• Mutation: N23 mutated to P23; a proline residue inserted between residues 23 and 24 of wild-type ecDHFR
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (unknown if destroyed)
• 3′ cloning site: BamHI (unknown if destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry