Skip to main content
Addgene

px330 Gatad2a sgRNA (for flox targeting)
(Plasmid #110815)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110815 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    px330
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 8520
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mGataD2a
  • Alt name
    p66a
  • gRNA/shRNA sequence
    gatacccatggtgcccacgg
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Entrez Gene
    Gatad2a (a.k.a. 1110066C11Rik)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer TGGCCTTTTGCTCACATGTG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330 Gatad2a sgRNA (for flox targeting) was a gift from Jacob Hanna (Addgene plasmid # 110815 ; http://n2t.net/addgene:110815 ; RRID:Addgene_110815)

  • For your References section:

    Neutralizing Gatad2a-Chd4-Mbd3/NuRD Complex Facilitates Deterministic Induction of Naive Pluripotency. Mor N, Rais Y, Sheban D, Peles S, Aguilera-Castrejon A, Zviran A, Elinger D, Viukov S, Geula S, Krupalnik V, Zerbib M, Chomsky E, Lasman L, Shani T, Bayerl J, Gafni O, Hanna S, Buenrostro JD, Hagai T, Masika H, Vainorius G, Bergman Y, Greenleaf WJ, Esteban MA, Elling U, Levin Y, Massarwa R, Merbl Y, Novershtern N, Hanna JH. Cell Stem Cell. 2018 Sep 6;23(3):412-425.e10. doi: 10.1016/j.stem.2018.07.004. Epub 2018 Aug 16. 10.1016/j.stem.2018.07.004 PubMed 30122475
Related items: