pRSF-T20S
(Plasmid #110805)

• Purpose: expresses Thermoplasma acidophilium 20S proteasome in E. Coli
• Depositing Lab: Yifan Cheng
• Publication: Yu et al Nat Commun. 2020 Sep 11;11(1):4580. doi: 10.1038/s41467-020-18415-7.

Backbone

• Vector backbone: pRSF
• Backbone manufacturer: Novagen
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: PsmB
• Mutation: N2D
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • tev-His (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: HindIII (unknown if destroyed)
• 5′ sequencing primer: GATCAGACTTTAGAAACTGG
• 3′ sequencing primer: AACTCGAGTTAGTGGTGGTGGTGGTGG

Gene/Insert 2

• Gene/Insert name: PsmA
• Mutation: Q2E
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TATGGCTAGCATGACTGGT

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry