Skip to main content
Addgene

pCMV/myc/ER-αT2ib
(Plasmid #110769)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110769 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA/myc/ER
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5044
  • Total vector size (bp) 5066
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    intrabody against mouse and human TLR2
  • Alt name
    scFv TLR2 10.1
  • Alt name
    Human/murine TLR2-cross-reactive intrabody
  • Alt name
    αT2ib
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    735
  • Promoter CMV
  • Tags / Fusion Proteins
    • myc epitope tag (C terminal on backbone)
    • ER retention signal (SEKDEL) (C terminal on backbone)
    • ER signal peptide (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV/myc/ER-αT2ib was a gift from Thomas Böldicke (Addgene plasmid # 110769 ; http://n2t.net/addgene:110769 ; RRID:Addgene_110769)

  • For your References section:

    Generation of anti-TLR2 intrabody mediating inhibition of macrophage surface TLR2 expression and TLR2-driven cell activation. Kirschning CJ, Dreher S, Maass B, Fichte S, Schade J, Koster M, Noack A, Lindenmaier W, Wagner H, Boldicke T. BMC Biotechnol. 2010 Apr 13;10:31. doi: 10.1186/1472-6750-10-31. 10.1186/1472-6750-10-31 PubMed 20388199
Related items: